Rt marker lane (M lanes). The symbol * indicates bands that correspond
Rt marker lane (M lanes). The symbol * indicates bands that correspond to the oligonucleotide alkylated and cleaved by CL, with loss of CL. Position of alkylation is evinced by…
E of 0.5? mm2 to better protect the antigen from degradation by
E of 0.5? mm2 to better protect the antigen from degradation by minimising the time spent in the rumen. In sheep, particles with diameters larger than 1.18 mm transit through…
Seased samples are denoted by black hatches. Expression is depicted as
Seased samples are denoted by black hatches. Expression is depicted as mean-normalized, 15900046 log2-transformed values. (D) Forty-nine genes were mutually dysregulated in the datasets tested and concordant in expression with…
Ed using surface sensitive techniques [1,2]. An example of an experiment demanding
Ed using surface sensitive techniques . An example of an experiment demanding such supramolecular structures at surfaces includes the binding of liposome-ssDNA hybrids to surface immobilized-DNA in order to detect…
Ison, WI). One ml of each reverse transcriptase reaction was used
Ison, WI). One ml of each reverse transcriptase reaction was used as a template in a PCR reaction containing the following specific primer pairs: Cyclophilin (at2g36130) AGTCCGCCGGAGGTTACGCT (as normalizer) and…
Ive; C) Human primary penile squamous cell carcinoma positive for high-risk
Ive; C) Human primary penile squamous cell carcinoma positive for high-risk HPV. p16 immunostaining in D) Histologically normal tumor margins; E) Human primary penile squamous cell carcinoma HPV-negative; F) Human…
Atic version of HT168; WM983B, cultured from a lymph node
Atic version of HT168; WM983B, cultured from a lymph node metastasis from the patient whose primary tumour gave rise to WM983A. Since CD44, as a cell surface glycoprotein, plays an…
D, and by Poole et al., [15] wherein sodium hyaluronate was injected
D, and by Poole et al., wherein sodium hyaluronate was injected to treat retinal detachments. Einmahl et al., observed that poly (ortho ester) injection in the SCS caused no clinical…
Mic period and the 2009?010 pandemic period. A shift to older ages
Mic period and the 2009?010 pandemic period. A shift to older ages in the age distribution of MedChemExpress Benzocaine hospitalized and fatal patients were observed during the winter season of…
E diet-induced obesity mice were fed the HFD in the control
E diet-induced obesity mice were fed the HFD in the control group or a modified HFD in the experimental group, in which the carbohydrate source was replaced with the resveratrol-enriched…